SUPPORT & TRAINING
Workshops
FAQs & Tech Notes
GeneSpring FAQ
Signet FAQ GeneSpring Tech Notes
Signet Tech Notes Online Training
Analysis Guides
Upgrades
GeneSpring Extras

 





Tech Notes

Q: How can I import partial sequence information in GeneSpring so that I can view genes in Physical Display and look for Regulatory sequences?

A: If the whole sequence is too large, you may enter partial sequence information into GeneSpring. To do this, you would treat each contig or partial sequence as an individual chromosome. There are several files that would need to be set up manually or modified:

1. A text file containing the sequence, in the following format:

>CHR1 data:
CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACCCACACACACA…
  GGTGGGTGTGGTGTGGTGTGTGGGTGTGGTGTGGGTGTGGTGTGTGTGGG
>CHR2 data:
AAATAGCCCTCATGTACGTCTCCTCCAAGCCCTGTTGTCTCTTACCCGGATGTTCAACCA…
  TGTGGTGTGTGGGTGTGT……

It is very important to start each Chromosome line with CHR followed by a numeric value. Save the file as an "All Files" type with an extension .seq. Make sure that no additional extensions, such as .txt, has been added to the file. If so, remove it.

2. Modify the Map column of the ORFs.txt file found in your genome folder (the genome folders are all located under the GeneSpring data directory). Enter the mapping information for each gene using this format:

ChromosomeNumber:starting_nt..ending_nt.

For example:

1:144003..147533
2:142177..143163
3:complement(139506..141434)

The chromosome number is followed by a colon (no spaces). The position of the starting and ending nucleotides are specified with ".." (no spaces) between them.

If a gene is on the complementary strand (that is if read from right to left in the .seq file), the term 'complement' has to precede the starting and end nucleotide.

NOTE: Enclose the start and end position of the complements in parentheses, and type position of end nucleotide first, then position of start nucleotide.

3. Create a file with a text editor. Enter the following lines:

name : name of your organism or array
ORFs : name of the _ORFs.txt file in which you have edited the mapping information
Sequence : name of the sequence file that you have created in the first step
KnowGenome : true
CircularGenome : true if yes, false if no.
ChromosomeNames : names of the chromosomes the way they will appear in the Physical View in GeneSpring. Example: I;II;III;IV;V;X


Save the file and name it "YourOrganism.genomedef". Make sure to save it as "All Files" format. Place it in the same directory as the sequence file and the _ORFs.txt file. Restart GeneSpring.




© 2005 Silicon Genetics/Agilent Technologies. All rights reserved. Terms of Use.
Contact us